Experimental setup

12/07/10

Home
Experimental setup
ATMT of new fungi
Molecular biology
Growth media

 

The following section describes which primers you will need to design for performing targeted genome modifications (deletion and in locus overexpression) in fungi by USER Friendly cloning

 

You will need primers for 1) construction of the vector, 2) verification of the vector and 3) verification of the genetically modified strain. Instruction and tips for the three different primer types can be found in the following sections.

(Need to obtain the Agrobacterium tumefaciens plasmids with USER cloning sites click here)

 

1. Primers for construction of the required vector:

  1. Design gene specific primers using a suitable program.
  2. Append the overhangs, as described below.
  3. When you order the primers, it is important that you specify that the primers contain a non-standard base: 2-Deoxyuridine which is the DNA version of uracil (sometimes this is specified as a modification depending of the vendor).

TIP: Save time and money - If you are going to do both targeted replacement and in locus overexpression of the same gene, reuse the primer 1 and 2 for both tasks (see below).

 

For replacement vectors  

Insert 1 (promoter region of target gene)     

Primer 1:        5- GGTCTTAAU-Gene specific sequence

Primer 2:        5- GGCATTAAU-Gene specific sequence

 

Insert 2 (terminator region of target gene)

Primer 3:        5- GGACTTAAU-Gene specific sequence

Primer 4:        5- GGGTTTAAU-Gene specific sequence

 

 

   (Download Excel template for the in silico implementation of the vector construction)

 

For overexpression vector

 

Insert 1 (promoter region of target gene)     

Primer 1:       5- GGTCTTAAU-Gene specific sequence

Primer 2:       5- GGCATTAAU-Gene specific sequence

 

Insert 2 (Start of target gene *)

Primer 3:        5- GGACTTAAU-Gene specific sequence

Primer 4:        5- GGGTTTAAU-Gene specific sequence

  

   (Download Excel template for the in silico implementation of the vector construction)

* The designed overhangs on primer 3 contains an AU which can be utilized as the two first bases in the start codon (ATG) of the gene that you want to overexpress. Meaning that when you design primers that amplify the start of (or entire) coding sequence it should start with a 5-T in the primer (forward direction) as fusion with the USER overhangs will result in the formation of a ATG, thereby giving you the first codon of the gene.

Note that the UCS in the pRF-HU2 and pRF-HU2E vectors are identical, why you only need to design three primer pairs to create vectors for both targeted replacement and in locus overexpression, if you place the primers in the following way:

 

2) Verification of the vector

I normally use the following standard primers to verify all constructs by PCR in combination with the terminal primers used for construction of the vector (remember to use Taq DNA polymerase as the construction primers include uracil).

Primer name Sequence 5'->3' In combination with
RF-1 5'-AAATTTTGTGCTCACCGCCTGGAC HU2 vector
RF-2 5'-TCTCCTTGCATGCACCATTCCTTG HU2 and HU2E vectors
RF-3 5'-TTGCGTCAGTCCAACATTTGTTGCCA HU2E vector

I also use these primers for sequencing of the constructs before proceeding to ATMT.

 

3) Verification of the genetically modified strain

For deletion strains I normally use four primer pairs:

  1. Testing for the selection marker*
  2. Testing for loss of the target gene (annealing at the center of the coding sequence)
  3. Testing for correct cross-over at the left flank (annealing upstream of the homologous recombination sequence, in combinations with RF-1, RF-2 or RF-3 depending of the construct)
  4. Testing for correct cross-over at the right flank (annealing downstream of the homologous recombination sequence, in combinations with RF-1, RF-2 or RF-3 depending of the construct)

 

      * For the vector depending on hygromycin resistance use the following primers

               Hyg588U: 5'- AGCTGCGCCGATGGTTTCTACAA

               Hyg588L:  5'- GCGCGTCTGCTGCTCCATACAA

 

 

 

 

Home | Experimental setup | ATMT of new fungi | Molecular biology | Growth media

Dette sted blev sidst opdateret 12. July 2010